Stem-loop sequence hsa-mir-1912

AccessionMI0008333 (change log)
Symbol HGNC:MIR1912
DescriptionHomo sapiens miR-1912 stem-loop
Gene family MIPF0000768; mir-1912
Literature search

6 open access papers mention hsa-mir-1912
(33 sentences)

Stem-loop
   ---     gg    g u         gg   u    a ua 
5'    cucua  augu c cauugcaug  cug guau g  u
      |||||  |||| | |||||||||  ||| |||| |  u
3'    gagau  uaca g gugacguac  gac caua c  a
   uua     aa    a u         ga   c    a uu 
Get sequence
Deep sequencing
1114 reads, 8.33 reads per million, 48 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 114651544-114651623 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-1912
hsa-mir-1912chrX: 114651544-114651623 [+]
hsa-mir-1264chrX: 114652655-114652723 [+]
Database links

Mature sequence hsa-miR-1912-5p

Accession MIMAT0037333
Sequence

13 - 

cucauugcaugggcuguguaua

 - 34

Get sequence
Deep sequencing619 reads, 25 experiments
Evidence experimental; Illumina [3]

Mature sequence hsa-miR-1912-3p

Accession MIMAT0007887
Sequence

46 - 

uacccagagcaugcagugugaa

 - 67

Get sequence
Deep sequencing493 reads, 41 experiments
Evidence experimental; 454 [1], SOLiD [2]
Database links
Predicted targets

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:19784364 "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP PLoS One. 4:e7192(2009).
3
PMID:25822230 "Selective microRNA-Offset RNA expression in human embryonic stem cells" Asikainen S, Heikkinen L, Juhila J, Holm F, Weltner J, Trokovic R, Mikkola M, Toivonen S, Balboa D, Lampela R, Icay K, Tuuri T, Otonkoski T, Wong G, Hovatta O PLoS One. 10:e0116668(2015).