Stem-loop sequence hsa-mir-1911

AccessionMI0008332 (change log)
Symbol HGNC:MIR1911
DescriptionHomo sapiens miR-1911 stem-loop
Gene family MIPF0001787; mir-1911
Literature search

3 open access papers mention hsa-mir-1911
(3 sentences)

Stem-loop
   -uc   a  u  u   u     c       u    cau c 
5'    ggc uc gc gag accgc augucug uggg   c a
      ||| || || ||| ||||| ||||||| ||||   |  
3'    ucg ag cg cuc uggug uacggac accc   g c
   guu   c  u  c   -     u       c    ucu a 
Get sequence
Deep sequencing
997 reads, 0 reads per million, 64 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 114763184-114763263 [+]
antisense
OTTHUMT00000470177 ; RP1-93I3.1-001; intron 2
OTTHUMT00000470178 ; RP1-93I3.1-002; intron 2
ENST00000607680 ; RP1-93I3.1-001; intron 2
ENST00000606397 ; RP1-93I3.1-002; intron 2
Database links

Mature sequence hsa-miR-1911-5p

Accession MIMAT0007885
Previous IDshsa-miR-1911
Sequence

12 - 

ugaguaccgccaugucuguuggg

 - 34

Get sequence
Deep sequencing924 reads, 52 experiments
Evidence experimental; 454 [1]
Predicted targets

Mature sequence hsa-miR-1911-3p

Accession MIMAT0007886
Previous IDshsa-miR-1911*
Sequence

49 - 

caccaggcauuguggucucc

 - 68

Get sequence
Deep sequencing72 reads, 34 experiments
Evidence experimental; 454 [1]
Predicted targets

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).