Stem-loop sequence hsa-mir-1910

AccessionMI0008331 (change log)
Symbol HGNC:MIR1910
DescriptionHomo sapiens miR-1910 stem-loop
Gene family MIPF0000987; mir-1910
Literature search

2 open access papers mention hsa-mir-1910
(2 sentences)

Stem-loop
   -  u    u  -gcca       gc     g     gugcu 
5'  ug cccu ca     guccugu  cugcc ccuuu     g
    || |||| ||     |||||||  ||||| |||||      
3'  ac ggga gu     uaggacg  gacgg gggag     u
   a  -    -  aacag       aa     a     guucc 
Get sequence
Deep sequencing
223 reads, 5.66 reads per million, 53 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 85741621-85741700 [-]
sense
OTTHUMT00000467249 ; C16orf74-005; intron 1
OTTHUMT00000467251 ; C16orf74-006; exon 2
OTTHUMT00000467250 ; C16orf74-007; intron 3
OTTHUMT00000467254 ; C16orf74-003; exon 3
OTTHUMT00000467252 ; C16orf74-004; exon 4
OTTHUMT00000467253 ; C16orf74-001; exon 4
OTTHUMT00000467255 ; C16orf74-002; exon 5
ENST00000602758 ; C16orf74-005; intron 1
ENST00000602583 ; C16orf74-006; exon 2
ENST00000602719 ; C16orf74-007; intron 3
ENST00000602914 ; C16orf74-003; exon 3
ENST00000602675 ; C16orf74-004; exon 4
ENST00000284245 ; C16orf74-001; exon 4
ENST00000602766 ; C16orf74-002; exon 5
Database links

Mature sequence hsa-miR-1910-5p

Accession MIMAT0007884
Sequence

12 - 

ccaguccugugccugccgccu

 - 32

Get sequence
Deep sequencing49 reads, 19 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

Mature sequence hsa-miR-1910-3p

Accession MIMAT0026917
Sequence

51 - 

gaggcagaagcaggaugaca

 - 70

Get sequence
Deep sequencing156 reads, 42 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).