Stem-loop sequence hsa-mir-1909

AccessionMI0008330 (change log)
Symbol HGNC:MIR1909
DescriptionHomo sapiens miR-1909 stem-loop
Gene family MIPF0000973; mir-1909
Literature search

6 open access papers mention hsa-mir-1909
(12 sentences)

Stem-loop
   cauc    acaa       ug  -   g     c u   g 
5'     cagg    uggugag  cc ggu ccugc c ggg c
       ||||    |||||||  || ||| ||||| | ||| c
3'     gucu    gccacuc  gg ccg ggacg g ccc g
   cccc    --ac       gu  g   g     c u   u 
Get sequence
Deep sequencing
63 reads, 2.7 reads per million, 37 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 1816159-1816238 [-]
sense
OTTHUMT00000449201 ; REXO1-007; intron 1
OTTHUMT00000449202 ; REXO1-006; exon 2
OTTHUMT00000449200 ; REXO1-001; intron 15
ENST00000587404 ; REXO1-007; intron 1
ENST00000411312 ; MIR1909-201; exon 1
ENST00000586291 ; REXO1-006; exon 2
ENST00000170168 ; REXO1-001; intron 15
Database links

Mature sequence hsa-miR-1909-5p

Accession MIMAT0007882
Previous IDshsa-miR-1909*
Sequence

16 - 

ugagugccggugccugcccug

 - 36

Get sequence
Deep sequencing15 reads, 10 experiments
Evidence experimental; 454 [1]
Predicted targets

Mature sequence hsa-miR-1909-3p

Accession MIMAT0007883
Previous IDshsa-miR-1909
Sequence

49 - 

cgcaggggccgggugcucaccg

 - 70

Get sequence
Deep sequencing41 reads, 28 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).