Stem-loop sequence hsa-mir-181d

AccessionMI0003139 (change log)
Symbol HGNC:MIR181D
DescriptionHomo sapiens miR-181d stem-loop
Gene family MIPF0000007; mir-181
Literature search

240 open access papers mention hsa-mir-181d
(842 sentences)

Stem-loop
         --      -     ----aca   ga       auca         g ug          guga  a u 
5' gucccc  uccccu aggcc       gcc  ggucaca    acauucauu u  ucgguggguu    gg c g
   ||||||  |||||| |||||       |||  |||||||    ||||||||| |  ||||||||||    || |  
3' cagggg  agggga uucgg       cgg  ucggugu    uguaaguag g  ggccacccag    cc g a
         ua      a     cacagac   -g       -cac         g --          ---a  - g 
Get sequence
Deep sequencing
634095 reads, 896 reads per million, 155 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 13874875-13875011 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-181d
hsa-mir-181cchr19: 13874699-13874808 [+]
hsa-mir-181dchr19: 13874875-13875011 [+]
Database links

Mature sequence hsa-miR-181d-5p

Accession MIMAT0002821
Sequence

36 - 

aacauucauuguugucggugggu

 - 58

Get sequence
Deep sequencing633950 reads, 155 experiments
Evidence experimental; array-cloned [1], cloned [2], Illumina [3]
Database links
Predicted targets

Mature sequence hsa-miR-181d-3p

Accession MIMAT0026608
Sequence

79 - 

ccaccgggggaugaaugucac

 - 99

Get sequence
Deep sequencing114 reads, 48 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).