Stem-loop sequence hsa-mir-15a

Accession MI0000069
Previous IDs hsa-mir-15
Symbol HGNC:MIR15A
Description Homo sapiens miR-15a stem-loop
Gene family MIPF0000006; mir-15
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-15_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-15 microRNA precursor family is made up of small non-coding RNA genes that regulate gene expression. The family includes the related mir-15a and mir-15b sequences, as well as miR-16-1, miR-16-2, miR-195 and miR-497. These six highly conserved miRNAs are clustered on three separate chromosomes. In humans miR-15a and miR-16 are clustered within 0.5 kilobases at chromosome position 13q14. This region has been found to be the most commonly affected in chronic lymphocytic leukaemia (CLL), with deletions of the entire region in more than half of cases. Both miR-15a and miR-16 are thus frequently deleted or down-regulated in CLL samples with 13q14 deletions; occurring in more than two thirds of CLL cases. miR-15a/16-1 deletion has been shown to accelerate the proliferation of both human and mouse B-cells through modulation of the expression of genes controlling cell cycle progression. Studies have found the miR-15a/16-1 microRNA cluster to function as a tumour suppressor, with the oncogene BCL2 as its target. Specifically, miR-15a/16-1 downregulates BCL2 expression and is itself deleted or downregulated in tumour cells. There is a marked increase in BCL2 levels observed in advanced prostate tumour cases, which is inversely correlated with miR-15a/16-1 expression (and so corresponds to a decrease in miR-15a/16-1 levels). Inhibition of cell proliferation by the miR-15a/16-1 cluster occurs in both lymphoid and non-lymphoid tissue. The miR-15a/16-1 cluster has further been found to be highly expressed in CD5+ cells, therefore hinting at an important role of miR-15/16 in normal CD5+ B-cell homeostasis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     gaguaaa ua        ua          ga  u 
ccuug       g  gcagcaca  augguuugug  uu u
|||||       |  ||||||||  ||||||||||  || g
ggaac       c  cgucgugu  uaccggacgu  aa a
     auaaaaa uc        ua          gg  a 
Get sequence
Deep sequencing
6500 reads, 44 experiments
Comments

Reference [1] named this sequence miR-15. This is renamed miR-15a here to avoid confusion with miR-15b (MI0000438 ) identified later by others. This gene and miR-16 are clustered within 0.5 kb at 13q14. This region has been shown to be deleted in more than half of B cell chronic lymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted or down-regulated in more than two thirds of CLL cases [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr13: 50623255-50623337 [-]
sense
OTTHUMT00000044954 ; DLEU2-001; intron 3
OTTHUMT00000044954 ; DLEU2-001; intron 3
OTTHUMT00000044955 ; DLEU2-002; exon 3
OTTHUMT00000044954 ; DLEU2-001; intron 3
OTTHUMT00000044955 ; DLEU2-002; exon 3
OTTHUMT00000044957 ; DLEU2-004; intron 4
OTTHUMT00000044960 ; DLEU2-007; intron 4
OTTHUMT00000044961 ; DLEU2-008; intron 4
OTTHUMT00000044956 ; DLEU2-003; exon 4
OTTHUMT00000044957 ; DLEU2-004; intron 4
OTTHUMT00000044960 ; DLEU2-007; intron 4
OTTHUMT00000044961 ; DLEU2-008; intron 4
OTTHUMT00000044956 ; DLEU2-003; exon 4
OTTHUMT00000044957 ; DLEU2-004; intron 4
OTTHUMT00000044960 ; DLEU2-007; intron 4
OTTHUMT00000044961 ; DLEU2-008; intron 4
OTTHUMT00000044958 ; DLEU2-005; intron 5
OTTHUMT00000044959 ; DLEU2-006; intron 5
OTTHUMT00000044958 ; DLEU2-005; intron 5
OTTHUMT00000044959 ; DLEU2-006; intron 5
OTTHUMT00000044958 ; DLEU2-005; intron 5
OTTHUMT00000044959 ; DLEU2-006; intron 5
ENST00000433070 ; DLEU2-001; intron 3
ENST00000433070 ; DLEU2-001; intron 3
ENST00000421758 ; DLEU2-002; exon 3
ENST00000433070 ; DLEU2-001; intron 3
ENST00000421758 ; DLEU2-002; exon 3
ENST00000425586 ; DLEU2-004; intron 4
ENST00000416253 ; DLEU2-007; intron 4
ENST00000458725 ; DLEU2-008; intron 4
ENST00000235290 ; DLEU2-201; intron 4
ENST00000449579 ; DLEU2-003; exon 4
ENST00000425586 ; DLEU2-004; intron 4
ENST00000416253 ; DLEU2-007; intron 4
ENST00000458725 ; DLEU2-008; intron 4
ENST00000235290 ; DLEU2-201; intron 4
ENST00000449579 ; DLEU2-003; exon 4
ENST00000425586 ; DLEU2-004; intron 4
ENST00000416253 ; DLEU2-007; intron 4
ENST00000458725 ; DLEU2-008; intron 4
ENST00000235290 ; DLEU2-201; intron 4
ENST00000443587 ; DLEU2-005; intron 5
ENST00000438752 ; DLEU2-006; intron 5
ENST00000443587 ; DLEU2-005; intron 5
ENST00000438752 ; DLEU2-006; intron 5
ENST00000443587 ; DLEU2-005; intron 5
ENST00000438752 ; DLEU2-006; intron 5
Clustered miRNAs
< 10kb from hsa-mir-15a
hsa-mir-15a chr13: 50623255-50623337 [-]
hsa-mir-16-1 chr13: 50623109-50623197 [-]
Database links

Mature sequence hsa-miR-15a-5p

Accession MIMAT0000068
Previous IDs hsa-miR-15a
Sequence

14 - 

uagcagcacauaaugguuugug

 - 35

Get sequence
Deep sequencing 6442 reads, 33 experiments
Evidence experimental; cloned [1,3-6], Northern [1]
Validated targets
Predicted targets

Mature sequence hsa-miR-15a-3p

Accession MIMAT0004488
Previous IDs hsa-miR-15a*
Sequence

51 - 

caggccauauugugcugccuca

 - 72

Get sequence
Deep sequencing 58 reads, 16 experiments
Evidence experimental; cloned [5]
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:12434020 "Frequent deletions and down-regulation of micro- RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia" Calin GA, Dumitru CD, Shimizu M, Bichi R, Zupo S, Noch E, Aldler H, Rattan S, Keating M, Rai K, Rassenti L, Kipps T, Negrini M, Bullrich F, Croce CM Proc Natl Acad Sci U S A. 99:15524-15529(2002).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).