Stem-loop sequence hsa-mir-1587

AccessionMI0016905 (change log)
Symbol HGNC:MIR1587
DescriptionHomo sapiens miR-1587 stem-loop
Literature search

1 open access papers mention hsa-mir-1587
(1 sentences)

Stem-loop
   u    -gc    c      g     u 
5'  uugg   uggg uggguu ggcag u
    ||||   |||| |||||| ||||| c
3'  gacc   gucc acucag ucguc u
   c    agu    -      g     u 
Get sequence
Deep sequencing
140 reads, 0 reads per million, 48 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 39837561-39837613 [+]
intergenic
Database links

Mature sequence hsa-miR-1587

Accession MIMAT0019077
Sequence

2 - 

uugggcugggcuggguuggg

 - 21

Get sequence
Deep sequencing131 reads, 45 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).