Stem-loop sequence hsa-mir-1539

AccessionMI0007260 (change log)
Symbol HGNC:MIR1539
DescriptionHomo sapiens miR-1539 stem-loop
Stem-loop
   -   -    c   c      uagc  g 
5'  ggc ucug ggc ugcagg    gc a
    ||| |||| ||| ||||||    ||  
3'  ccg agac cug gcgucc    ug a
   c   u    c   c      ----  a 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr18: 49487373-49487422 [+]
intergenic
Database links

Mature sequence hsa-miR-1539

Accession MIMAT0007401
Sequence

30 - 

uccugcgcgucccagaugccc

 - 50

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; ChIP-seq [1]
Predicted targets

References

1
PMID:18524951 "Characterization of endogenous human Argonautes and their miRNA partners in RNA silencing" Azuma-Mukai A, Oguri H, Mituyama T, Qian ZR, Asai K, Siomi H, Siomi MC Proc Natl Acad Sci U S A. 105:7964-7969(2008).