Stem-loop sequence hsa-mir-1538

AccessionMI0007259 (change log)
Symbol HGNC:MIR1538
DescriptionHomo sapiens miR-1538 stem-loop
Gene family MIPF0000903; mir-1538
Literature search

3 open access papers mention hsa-mir-1538
(5 sentences)

Stem-loop
                a a      u    uc 
5' gggaacagcagca c ugggcc cgcu  c
   ||||||||||||| | |||||| ||||  u
3' uccuugucgucgu g gcccgg gcgg  g
                c g      c    cc 
Get sequence
Deep sequencing
101 reads, 0 reads per million, 54 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 69565808-69565868 [-]
intergenic
Database links

Mature sequence hsa-miR-1538

Accession MIMAT0007400
Sequence

39 - 

cggcccgggcugcugcuguuccu

 - 61

Get sequence
Deep sequencing58 reads, 33 experiments
Evidence experimental; ChIP-seq [1]
Predicted targets

References

1
PMID:18524951 "Characterization of endogenous human Argonautes and their miRNA partners in RNA silencing" Azuma-Mukai A, Oguri H, Mituyama T, Qian ZR, Asai K, Siomi H, Siomi MC Proc Natl Acad Sci U S A. 105:7964-7969(2008).