Stem-loop sequence hsa-mir-1471

AccessionMI0007076 (change log)
Symbol HGNC:MIR1471
DescriptionHomo sapiens miR-1471 stem-loop
Gene family MIPF0001069; mir-1471
Literature search

4 open access papers mention hsa-mir-1471
(6 sentences)

Stem-loop
       -g  -ug         g   a agg 
5' gccc  cg   uggagccag ugu g   c
   ||||  ||   ||||||||| ||| |    
3' cggg  gu   aucucgguc aca c   g
       ga  uua         g   - gag 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 231892242-231892298 [-]
intergenic
Database links

Mature sequence hsa-miR-1471

Accession MIMAT0007349
Sequence

1 - 

gcccgcguguggagccaggugu

 - 22

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:18402656 "Hidden layers of human small RNAs" Kawaji H, Nakamura M, Takahashi Y, Sandelin A, Katayama S, Fukuda S, Daub CO, Kai C, Kawai J, Yasuda J, Carninci P, Hayashizaki Y BMC Genomics. 9:157(2008).