Stem-loop sequence hsa-mir-1469

AccessionMI0007074 (change log)
Symbol HGNC:MIR1469
DescriptionHomo sapiens miR-1469 stem-loop
Gene family MIPF0000979; mir-1469
Literature search

8 open access papers mention hsa-mir-1469
(12 sentences)

Stem-loop
   -       cgg   gcgg     g 
5'  cucggcg   ggc    gcucc g
    |||||||   |||    ||||| g
3'  gggccgc   ccg    cgggg u
   g       -aa   --ag     u 
Get sequence
Deep sequencing
62 reads, 10 reads per million, 40 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 96333261-96333307 [+]
intergenic
Database links

Mature sequence hsa-miR-1469

Accession MIMAT0007347
Sequence

1 - 

cucggcgcggggcgcgggcucc

 - 22

Get sequence
Deep sequencing60 reads, 43 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:18402656 "Hidden layers of human small RNAs" Kawaji H, Nakamura M, Takahashi Y, Sandelin A, Katayama S, Fukuda S, Daub CO, Kai C, Kawai J, Yasuda J, Carninci P, Hayashizaki Y BMC Genomics. 9:157(2008).