Stem-loop sequence hsa-mir-1468

AccessionMI0003782 (change log)
Symbol HGNC:MIR1468
DescriptionHomo sapiens miR-1468 stem-loop
Gene family MIPF0000777; mir-1468
Literature search

3 open access papers mention hsa-mir-1468
(137 sentences)

Stem-loop
        gu gu  c         c     c     -u   cau 
5' ggugg  g  uu uccguuugc uguuu gcuga  gug   u
   |||||  |  || ||||||||| ||||| |||||  |||   c
3' cuacc  c  aa agguaaacg auaaa cgacu  uac   a
        ug uu  a         a     a     cu   uca 
Get sequence
Deep sequencing
941 reads, 0.8 reads per million, 125 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al [1], and confirmed later by cloning [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 63786002-63786087 [-]
intergenic
Database links

Mature sequence hsa-miR-1468-5p

Accession MIMAT0006789
Sequence

13 - 

cuccguuugccuguuucgcug

 - 33

Get sequence
Deep sequencing928 reads, 125 experiments
Evidence experimental; cloned [2], Illumina [3]
Database links
Predicted targets

Mature sequence hsa-miR-1468-3p

Accession MIMAT0026638
Sequence

55 - 

agcaaaauaagcaaauggaaaa

 - 76

Get sequence
Deep sequencing11 reads, 10 experiments
Evidence experimental; Illumina [3]
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:18402656 "Hidden layers of human small RNAs" Kawaji H, Nakamura M, Takahashi Y, Sandelin A, Katayama S, Fukuda S, Daub CO, Kai C, Kawai J, Yasuda J, Carninci P, Hayashizaki Y BMC Genomics. 9:157(2008).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).