Stem-loop sequence hsa-mir-1323

AccessionMI0003786 (change log)
Symbol HGNC:MIR1323
DescriptionHomo sapiens miR-1323 stem-loop
Gene family MIPF0000617; mir-1323
Literature search

5 open access papers mention hsa-mir-1323
(8 sentences)

Stem-loop
   ac   g             a  g         gugg 
5'   uga guccucaaaacug gg gcauuuucu    u
     ||| ||||||||||||| || |||||||||    u
3'   acu uagggguuuugac cc cgugaaagg    u
   -a   g             -  a         aaag 
Get sequence
Deep sequencing
608 reads, 7.41 reads per million, 54 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al [1], and confirmed later by cloning [2]. Afanasyeva et al. refer to this sequence using the internal identifier MYCNAMP_NB2_61 [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 53671968-53672040 [+]
antisense
OTTHUMT00000464179 ; ZNF665-002; intron 1
OTTHUMT00000464180 ; ZNF665-001; intron 3
ENST00000600412 ; ZNF665-002; intron 1
ENST00000396424 ; ZNF665-001; intron 3
Clustered miRNAs
< 10kb from hsa-mir-1323
hsa-mir-512-1chr19: 53666679-53666762 [+]
hsa-mir-512-2chr19: 53669157-53669254 [+]
hsa-mir-1323chr19: 53671968-53672040 [+]
hsa-mir-498chr19: 53674197-53674320 [+]
hsa-mir-520echr19: 53675711-53675797 [+]
hsa-mir-515-1chr19: 53679003-53679085 [+]
hsa-mir-519echr19: 53679940-53680023 [+]
Database links

Mature sequence hsa-miR-1323

Accession MIMAT0005795
Sequence

11 - 

ucaaaacugaggggcauuuucu

 - 32

Get sequence
Deep sequencing603 reads, 51 experiments
Evidence experimental; RAKE [1], cloned [2]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:18230126 "New miRNAs cloned from neuroblastoma" Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F BMC Genomics. 9:52(2008).