Stem-loop sequence hsa-mir-1306

AccessionMI0006443 (change log)
Symbol HGNC:MIR1306
DescriptionHomo sapiens miR-1306 stem-loop
Gene family MIPF0000531; mir-1306
Literature search

13 open access papers mention hsa-mir-1306
(54 sentences)

Stem-loop
   g  ag a    -c       uccccu  a        gugg   a 
5'  ug  c gucu  caccacc      gc aacgucca    ugc g
    ||  | ||||  |||||||      || ||||||||    |||  
3'  gc  g cagg  guggugg      cg uugcaggu    aug a
   a  cu a    ua       ---ucu  g        ---a   g 
Get sequence
Deep sequencing
6511 reads, 6.45 reads per million, 155 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr22: 20086058-20086142 [+]
sense
OTTHUMT00000318660 ; DGCR8-007; intron 1
OTTHUMT00000318657 ; DGCR8-004; intron 6
OTTHUMT00000318655 ; DGCR8-002; intron 7
OTTHUMT00000318656 ; DGCR8-003; intron 7
OTTHUMT00000318654 ; DGCR8-001; intron 9
ENST00000491892 ; DGCR8-007; intron 1
ENST00000498171 ; DGCR8-004; intron 6
ENST00000495826 ; DGCR8-002; intron 7
ENST00000407755 ; DGCR8-003; intron 7
ENST00000383024 ; DGCR8-201; intron 8
ENST00000351989 ; DGCR8-001; intron 9
Clustered miRNAs
< 10kb from hsa-mir-1306
hsa-mir-3618chr22: 20085746-20085833 [+]
hsa-mir-1306chr22: 20086058-20086142 [+]
Database links

Mature sequence hsa-miR-1306-5p

Accession MIMAT0022726
Sequence

15 - 

ccaccuccccugcaaacgucca

 - 36

Get sequence
Deep sequencing4159 reads, 152 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence hsa-miR-1306-3p

Accession MIMAT0005950
Previous IDshsa-miR-1306
Sequence

55 - 

acguuggcucugguggug

 - 72

Get sequence
Deep sequencing2325 reads, 120 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).