Stem-loop sequence hsa-mir-1305

AccessionMI0006372 (change log)
Symbol HGNC:MIR1305
DescriptionHomo sapiens miR-1305 stem-loop
Gene family MIPF0000965; mir-1305
Literature search

7 open access papers mention hsa-mir-1305
(63 sentences)

Stem-loop
   --aa               a       uu     uguu    g 
5'     gauccugcuguuucu ccauuag  uugaa    uauu u
       ||||||||||||||| |||||||  |||||    |||| a
3'     uuaggacgacagaga gguaauc  aacuu    auag a
   ccuc               g       uc     -uuc    a 
Get sequence
Deep sequencing
431 reads, 0 reads per million, 62 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 182169293-182169378 [+]
intergenic
Database links

Mature sequence hsa-miR-1305

Accession MIMAT0005893
Sequence

51 - 

uuuucaacucuaaugggagaga

 - 72

Get sequence
Deep sequencing392 reads, 49 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).