Stem-loop sequence hsa-mir-1304

AccessionMI0006371 (change log)
Symbol HGNC:MIR1304
DescriptionHomo sapiens miR-1304 stem-loop
Gene family MIPF0001064; mir-1304
Literature search

15 open access papers mention hsa-mir-1304
(39 sentences)

Stem-loop
   --aaa             c                        au 
5'      cacuugagcccag gguuugaggcuacagugagaugug  c
        ||||||||||||| ||||||||||||||||||||||||  c
3'      gugaacucggguc ccaagcuccgaugucacucuacac  u
   acuua             c                        cg 
Get sequence
Deep sequencing
7918 reads, 51.9 reads per million, 160 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 93733674-93733764 [-]
intergenic
Database links

Mature sequence hsa-miR-1304-5p

Accession MIMAT0005892
Previous IDshsa-miR-1304
Sequence

20 - 

uuugaggcuacagugagaugug

 - 41

Get sequence
Deep sequencing3610 reads, 110 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-1304-3p

Accession MIMAT0022720
Sequence

53 - 

ucucacuguagccucgaacccc

 - 74

Get sequence
Deep sequencing3863 reads, 143 experiments
Evidence not experimental
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).