Stem-loop sequence hsa-mir-1303

AccessionMI0006370 (change log)
Symbol HGNC:MIR1303
DescriptionHomo sapiens miR-1303 stem-loop
Gene family MIPF0000608; mir-1303
Literature search

10 open access papers mention hsa-mir-1303
(48 sentences)

Stem-loop
   --    g       u           aa     c     uuuu 
5'   ggcu ggcaaca agcgagaccuc  cucua aauuu    u
     |||| ||||||| |||||||||||  ||||| |||||     
3'   ucgg ccguugu ucguucugggg  gagau uuaaa    u
   uu    a       c           ca     u     uuuu 
Get sequence
Deep sequencing
6271 reads, 48.7 reads per million, 158 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 154685776-154685861 [+]
intergenic
Database links

Mature sequence hsa-miR-1303

Accession MIMAT0005891
Sequence

52 - 

uuuagagacggggucuugcucu

 - 73

Get sequence
Deep sequencing4145 reads, 154 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).