Stem-loop sequence hsa-mir-1302-1

AccessionMI0006362 (change log)
Symbol HGNC:MIR1302-1
DescriptionHomo sapiens miR-1302-1 stem-loop
Gene family MIPF0000456; mir-1302
Literature search

7 open access papers mention hsa-mir-1302-1
(87 sentences)

Stem-loop
   --   aaag  c     a            ag   a   u        gug  -      a  a     uac 
5'   cag    cc aguua auuugaauuuca  uaa caa gaauaauu   ua uguaag au uccca   a
     |||    || ||||| ||||||||||||  ||| ||| ||||||||   || |||||| || |||||   a
3'   guc    gg ucaau uaaacuuaaagu  auu guu cuuauuaa   au guauuc ua agggu   u
   au   cuua  a     g            cu   c   c        -aa  c      a  c     uua 
Get sequence
Deep sequencing
211 reads, 0 reads per million, 54 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 112695034-112695176 [-]
sense
OTTHUMT00000405224 ; HECTD4-002; intron 10
OTTHUMT00000405222 ; HECTD4-001; intron 20
ENST00000311694 ; HECTD4-002; intron 10
ENST00000377560 ; HECTD4-201; intron 19
ENST00000430131 ; HECTD4-202; intron 19
ENST00000550722 ; HECTD4-001; intron 20
antisense
OTTHUMT00000405416 ; RP3-521E19.2-001; intron 1
ENST00000547401 ; RP3-521E19.2-001; intron 1
Database links

Mature sequence hsa-miR-1302

Accession MIMAT0005890
Sequence

75 - 

uugggacauacuuaugcuaaa

 - 95

Get sequence
Deep sequencing653 reads, 33 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).