Stem-loop sequence hsa-mir-1301

AccessionMI0003815 (change log)
Symbol HGNC:MIR1301
DescriptionHomo sapiens miR-1301 stem-loop
Gene family MIPF0000742; mir-1301
Literature search

10 open access papers mention hsa-mir-1301
(16 sentences)

Stem-loop
   --        g           -     - c      -  gu 
5'   ggauugug ggggucgcucu aggca c gcagca cu  g
     |||||||| ||||||||||| ||||| | |||||| ||  c
3'   ccugacac cuucagugagg uccgu g cguugu gg  u
   cu        a           g     c a      a  gg 
Get sequence
Deep sequencing
24305 reads, 50 reads per million, 158 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 25328640-25328721 [-]
antisense
OTTHUMT00000324700 ; EFR3B-002; intron 4
OTTHUMT00000324808 ; EFR3B-003; intron 4
OTTHUMT00000324699 ; EFR3B-001; intron 4
ENST00000401432 ; EFR3B-002; intron 4
ENST00000403714 ; EFR3B-003; intron 4
ENST00000402191 ; EFR3B-001; intron 4
Database links

Mature sequence hsa-miR-1301-5p

Accession MIMAT0026639
Sequence

15 - 

cgcucuaggcaccgcagca

 - 33

Get sequence
Deep sequencing134 reads, 39 experiments
Evidence experimental; Illumina [5]
Predicted targets

Mature sequence hsa-miR-1301-3p

Accession MIMAT0005797
Sequence

48 - 

uugcagcugccugggagugacuuc

 - 71

Get sequence
Deep sequencing24164 reads, 155 experiments
Evidence experimental; Illumina [2,5], 454 [3-4]
Database links
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).
3
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
4
PMID:19508715 "Identification and analysis of miRNAs in human breast cancer and teratoma samples using deep sequencing" Nygaard S, Jacobsen A, Lindow M, Eriksen J, Balslev E, Flyger H, Tolstrup N, Moller S, Krogh A, Litman T BMC Med Genomics. 2:35(2009).
5
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).