Stem-loop sequence hsa-mir-1299

AccessionMI0006359 (change log)
Symbol HGNC:MIR1299
DescriptionHomo sapiens miR-1299 stem-loop
Gene family MIPF0000625; mir-1299
Literature search

9 open access papers mention hsa-mir-1299
(19 sentences)

Stem-loop
   --       g   u    ug    ---c       a  gacaau 
5'   ccucaug cag guuc  gaau    cuacgug gg      c
     ||||||| ||| ||||  ||||    ||||||| ||       
3'   ggagugu guc uaag  cuug    gaugcac cc      a
   ag       -   u    gu    ugac       -  agacuu 
Get sequence
Deep sequencing
5641 reads, 6.02 reads per million, 133 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 40929010-40929092 [-]
intergenic
Database links

Mature sequence hsa-miR-1299

Accession MIMAT0005887
Sequence

62 - 

uucuggaauucugugugaggga

 - 83

Get sequence
Deep sequencing4578 reads, 121 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).