Stem-loop sequence hsa-mir-1295b

AccessionMI0019146 (change log)
Symbol HGNC:MIR1295B
DescriptionHomo sapiens miR-1295b stem-loop
Literature search

1 open access papers mention hsa-mir-1295b
(2 sentences)

Stem-loop
   -ca          c      a   c   c 
5'    cccagaucug ggccua uca agg c
      |||||||||| |||||| ||| ||| a
3'    gggucuaggc ccggau agu uuu c
   aac          a      a   c   a 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 171101739-171101798 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-1295b
hsa-mir-1295achr1: 171101728-171101806 [-]
hsa-mir-1295bchr1: 171101739-171101798 [+]
Database links

Mature sequence hsa-miR-1295b-5p

Accession MIMAT0022293
Sequence

1 - 

cacccagaucugcggccuaau

 - 21

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-1295b-3p

Accession MIMAT0022294
Sequence

39 - 

aauaggccacggaucugggcaa

 - 60

Get sequence
Deep sequencing5 reads, 4 experiments
Evidence not experimental
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).