Stem-loop sequence hsa-mir-1294

AccessionMI0006356 (change log)
Symbol HGNC:MIR1294
DescriptionHomo sapiens miR-1294 stem-loop
Gene family MIPF0000603; mir-1294
Literature search

3 open access papers mention hsa-mir-1294
(5 sentences)

Stem-loop
   --     aaugugug  aa     gu   u  a g       c                          c  g  u 
5'   caccu        cc  gaucu  uca uu u aucucac gaguccugugagguuggcauuguugu ug ca u
     |||||        ||  |||||  ||| || | ||||||| |||||||||||||||||||||||||| || || g
3'   gugga        gg  uuagg  agu aa a uggagug cucaggacacuccaaccgugacaaca au gu u
   au     -------a  -a     --   c  - g       a                          u  a  c 
Get sequence
Deep sequencing
777 reads, 6.03 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 154347106-154347247 [+]
sense
OTTHUMT00000377471 ; MRPL22-002; exon 6
OTTHUMT00000252508 ; MRPL22-001; exon 7
OTTHUMT00000377473 ; MRPL22-003; exon 7
ENST00000265229 ; MRPL22-002; exon 6
ENST00000523037 ; MRPL22-001; exon 7
ENST00000522038 ; MRPL22-003; exon 7
Database links

Mature sequence hsa-miR-1294

Accession MIMAT0005884
Sequence

48 - 

ugugagguuggcauuguugucu

 - 69

Get sequence
Deep sequencing625 reads, 103 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).