Stem-loop sequence hsa-mir-1292

AccessionMI0006433 (change log)
Symbol HGNC:MIR1292
DescriptionHomo sapiens miR-1292 stem-loop
Gene family MIPF0000675; mir-1292
Literature search

3 open access papers mention hsa-mir-1292
(8 sentences)

Stem-loop
        g      uu    ca a   u   -   g 
5' ccugg aacggg  ccgg  g cgc gag guu c
   ||||| ||||||  ||||  | ||| ||| ||| g
3' ggacc uugccc  ggcc  c gcg cuc cag u
        -      uc    -c -   -   g   u 
Get sequence
Deep sequencing
2572 reads, 0 reads per million, 97 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr20: 2652777-2652842 [+]
intergenic
Database links

Mature sequence hsa-miR-1292-5p

Accession MIMAT0005943
Previous IDshsa-miR-1292
Sequence

3 - 

ugggaacggguuccggcagacgcug

 - 27

Get sequence
Deep sequencing2541 reads, 93 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-1292-3p

Accession MIMAT0022948
Sequence

43 - 

ucgcgccccggcucccguuc

 - 62

Get sequence
Deep sequencing31 reads, 19 experiments
Evidence not experimental
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).