Stem-loop sequence hsa-mir-1291

AccessionMI0006353 (change log)
Symbol HGNC:MIR1291
DescriptionHomo sapiens miR-1291 stem-loop
Gene family MIPF0000599; mir-1291
Literature search

11 open access papers mention hsa-mir-1291
(122 sentences)

Stem-loop
   --  u   -au   -agu    -   a  ga           ug   
5'   gg aga   ucc    ggcc cug cu  agaccagcagu  ua 
     || |||   |||    |||| ||| ||  |||||||||||  | c
3'   cc ucu   agg    ccgg gac ga  uuugguugucg  gu 
   gu  u   guc   aaau    a   -  ac           gu   
Get sequence
Deep sequencing
3644 reads, 8.15 reads per million, 135 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 48654444-48654530 [-]
sense
OTTHUMT00000406515 ; RP11-370I10.2-001; intron 2
ENST00000547523 ; RP11-370I10.2-001; intron 2
Database links

Mature sequence hsa-miR-1291

Accession MIMAT0005881
Sequence

14 - 

uggcccugacugaagaccagcagu

 - 37

Get sequence
Deep sequencing3545 reads, 129 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).