Stem-loop sequence hsa-mir-1289-1

AccessionMI0006350 (change log)
Symbol HGNC:MIR1289-1
DescriptionHomo sapiens miR-1289-1 stem-loop
Gene family MIPF0000626; mir-1289
Literature search

1 open access papers mention hsa-mir-1289-1
(1 sentences)

Stem-loop
   --         uuuagua       aaaacaaa   --ggu         c      u          ---ag  a 
5'   uucucaauu       ggaauua        acu     aaaugcaga ucuugg uuccaccccc     ag a
     |||||||||       |||||||        |||     ||||||||| |||||| ||||||||||     || u
3'   aaggguuaa       ucuuagu        uga     uuuacgucu aggacc gagguggggg     uc c
   ac         ----uag       gggaccca   aagau         a      u          ccaaa  c 
Get sequence
Deep sequencing
161 reads, 146 reads per million, 76 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr20: 35453954-35454097 [-]
sense
OTTHUMT00000276635 ; SOGA1-005; intron 3
OTTHUMT00000276634 ; SOGA1-003; intron 3
ENST00000237536 ; SOGA1-005; intron 3
ENST00000279034 ; SOGA1-003; intron 3
ENST00000357779 ; SOGA1-201; intron 3
Database links

Mature sequence hsa-miR-1289

Accession MIMAT0005879
Sequence

86 - 

uggaguccaggaaucugcauuuu

 - 108

Get sequence
Deep sequencing204 reads, 59 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).