Stem-loop sequence hsa-mir-1288

AccessionMI0006432 (change log)
Symbol HGNC:MIR1288
DescriptionHomo sapiens miR-1288 stem-loop
Gene family MIPF0000660; mir-1288
Literature search

3 open access papers mention hsa-mir-1288
(5 sentences)

Stem-loop
   g     gu  a  ag         acu   ac     a 
5'  agggu  ug uc  cagaucagg   gua  ucacc u
    |||||  || ||  |||||||||   |||  ||||| a
3'  uuccg  ac ag  gucuagucc   cgu  ggugg g
   -     uc  c  ag         ---   ca     u 
Get sequence
Deep sequencing
121 reads, 0 reads per million, 53 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 16282014-16282088 [+]
intergenic
Database links

Mature sequence hsa-miR-1288-5p

Accession MIMAT0026743
Sequence

15 - 

gcagaucaggacuguaacucacc

 - 37

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence hsa-miR-1288-3p

Accession MIMAT0005942
Sequence

45 - 

uggacugcccugaucuggaga

 - 65

Get sequence
Deep sequencing115 reads, 50 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).