Stem-loop sequence hsa-mir-1287

AccessionMI0006349 (change log)
Symbol HGNC:MIR1287
DescriptionHomo sapiens miR-1287 stem-loop
Gene family MIPF0000725; mir-1287
Literature search

3 open access papers mention hsa-mir-1287
(14 sentences)

Stem-loop
   --  ug  cug     gu    g   a      c    cu a  cuu 
5'   gu  ug   uccag  gcug auc gugguu gagu  g gc   u
     ||  ||   |||||  |||| ||| |||||| ||||  | ||    
3'   ca  ac   agguu  ugac uag caccga cuca  c cg   a
   aa  gu  -cg     ag    g   a      u    -- -  aaa 
Get sequence
Deep sequencing
4344 reads, 7.43 reads per million, 148 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 98395218-98395307 [-]
sense
OTTHUMT00000049620 ; PIK3AP1-002; intron 7
OTTHUMT00000049621 ; PIK3AP1-003; intron 7
OTTHUMT00000049619 ; PIK3AP1-001; intron 8
ENST00000371110 ; PIK3AP1-002; intron 7
ENST00000468783 ; PIK3AP1-003; intron 7
ENST00000339364 ; PIK3AP1-001; intron 8
Database links

Mature sequence hsa-miR-1287-5p

Accession MIMAT0005878
Sequence

16 - 

ugcuggaucagugguucgaguc

 - 37

Get sequence
Deep sequencing3870 reads, 142 experiments
Evidence experimental; Illumina [1,3], 454 [2]
Database links
Predicted targets

Mature sequence hsa-miR-1287-3p

Accession MIMAT0026738
Sequence

55 - 

cucuagccacagaugcagugau

 - 76

Get sequence
Deep sequencing451 reads, 103 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).
2
PMID:19508715 "Identification and analysis of miRNAs in human breast cancer and teratoma samples using deep sequencing" Nygaard S, Jacobsen A, Lindow M, Eriksen J, Balslev E, Flyger H, Tolstrup N, Moller S, Krogh A, Litman T BMC Med Genomics. 2:35(2009).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).