Stem-loop sequence hsa-mir-1286

AccessionMI0006348 (change log)
Symbol HGNC:MIR1286
DescriptionHomo sapiens miR-1286 stem-loop
Gene family MIPF0000682; mir-1286
Literature search

4 open access papers mention hsa-mir-1286
(8 sentences)

Stem-loop
   --ug   u ug   a    g    c   g  u     au 
5'     ucc c  ggg cuca cuug ucu gc gcugg  u
       ||| |  ||| |||| |||| ||| || |||||   
3'     agg g  ucc gagu gaac agg cg cgauu  g
   acag   u gu   c    a    c   a  u     aa 
Get sequence
Deep sequencing
696 reads, 0 reads per million, 59 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr22: 20249134-20249211 [-]
sense
OTTHUMT00000318964 ; RTN4R-002; intron 1
OTTHUMT00000318950 ; RTN4R-001; intron 1
OTTHUMT00000318968 ; RTN4R-006; intron 1
OTTHUMT00000318967 ; RTN4R-005; intron 1
OTTHUMT00000318969 ; RTN4R-007; intron 2
ENST00000416372 ; RTN4R-002; intron 1
ENST00000043402 ; RTN4R-001; intron 1
ENST00000469601 ; RTN4R-006; intron 1
ENST00000463936 ; RTN4R-005; intron 1
ENST00000474642 ; RTN4R-007; intron 2
Database links

Mature sequence hsa-miR-1286

Accession MIMAT0005877
Sequence

47 - 

ugcaggaccaagaugagcccu

 - 67

Get sequence
Deep sequencing659 reads, 50 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).