Stem-loop sequence hsa-mir-1285-1

AccessionMI0006346 (change log)
Symbol HGNC:MIR1285-1
DescriptionHomo sapiens miR-1285-1 stem-loop
Gene family MIPF0000559; mir-1285
Literature search

26 open access papers mention hsa-mir-1285-1
(70 sentences)

Stem-loop
   --            a                    ug ucuc 
5'   uguagagauagg ucucacuuuguugcccaggc  g    a
     |||||||||||| ||||||||||||||||||||  |     
3'   acaucucuauuc agagugaaacaacgggucug  c    a
   ga            c                    gu cuca 
Get sequence
Deep sequencing
27425 reads, 392 reads per million, 170 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 92204015-92204098 [-]
sense
OTTHUMT00000342184 ; FAM133B-007; intron 1
OTTHUMT00000342188 ; FAM133B-011; intron 2
OTTHUMT00000342185 ; FAM133B-008; intron 3
OTTHUMT00000342061 ; FAM133B-003; intron 7
OTTHUMT00000342181 ; FAM133B-001; intron 8
OTTHUMT00000342060 ; FAM133B-002; intron 8
OTTHUMT00000342182 ; FAM133B-005; intron 8
OTTHUMT00000342062 ; FAM133B-004; intron 9
ENST00000468931 ; FAM133B-007; intron 1
ENST00000490747 ; FAM133B-011; intron 2
ENST00000494079 ; FAM133B-008; intron 3
ENST00000481407 ; FAM133B-003; intron 7
ENST00000445716 ; FAM133B-001; intron 8
ENST00000415397 ; FAM133B-002; intron 8
ENST00000427372 ; FAM133B-005; intron 8
ENST00000438306 ; FAM133B-004; intron 9
Database links

Mature sequence hsa-miR-1285-5p

Accession MIMAT0022719
Sequence

12 - 

gaucucacuuuguugcccagg

 - 32

Get sequence
Deep sequencing3850 reads, 155 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence hsa-miR-1285-3p

Accession MIMAT0005876
Previous IDshsa-miR-1285
Sequence

51 - 

ucugggcaacaaagugagaccu

 - 72

Get sequence
Deep sequencing17819 reads, 154 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).