Stem-loop sequence hsa-mir-1284

AccessionMI0006431 (change log)
Symbol HGNC:MIR1284
DescriptionHomo sapiens miR-1284 stem-loop
Gene family MIPF0000604; mir-1284
Literature search

7 open access papers mention hsa-mir-1284
(18 sentences)

Stem-loop
   --------auuu   uauau        uuaau      u        ccu        uuaaauu 
5'             uga     aagccagu     guuuuc auacagac   ggcuuuuc       u
               |||     ||||||||     |||||| ||||||||   ||||||||        
3'             acu     uuuggucg     caaagg uauguuug   ccgaaagg       u
   ucuaaaagucau   --uuc        ----u      u        uac        uuauaua 
Get sequence
Deep sequencing
611 reads, 0 reads per million, 92 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 71541970-71542089 [-]
sense
OTTHUMT00000352252 ; FOXP1-003; intron 1
OTTHUMT00000352253 ; FOXP1-004; intron 2
OTTHUMT00000352250 ; FOXP1-001; intron 3
OTTHUMT00000352251 ; FOXP1-002; intron 3
OTTHUMT00000352262 ; FOXP1-014; intron 3
ENST00000327590 ; FOXP1-003; intron 1
ENST00000475937 ; FOXP1-004; intron 2
ENST00000318789 ; FOXP1-001; intron 3
ENST00000493089 ; FOXP1-002; intron 3
ENST00000318779 ; FOXP1-014; intron 3
Database links

Mature sequence hsa-miR-1284

Accession MIMAT0005941
Sequence

30 - 

ucuauacagacccuggcuuuuc

 - 51

Get sequence
Deep sequencing416 reads, 80 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).