Stem-loop sequence hsa-mir-1282

AccessionMI0006429 (change log)
Symbol HGNC:MIR1282
DescriptionHomo sapiens miR-1282 stem-loop
Gene family MIPF0000587; mir-1282
Literature search

5 open access papers mention hsa-mir-1282
(6 sentences)

Stem-loop
   ccuucu   cg          uc       ----   g   g     cgag   c 
5'       ucu  uuugccuuuu  ugcuucu    gcu cau aucuc    ucc u
         |||  ||||||||||  |||||||    ||| ||| |||||    |||  
3'       agg  aaacgggaga  auggagg    cgg gua uagag    ggg g
   -----c   aa          cc       guca   g   g     --au   g 
Get sequence
Deep sequencing
36 reads, 116 reads per million, 25 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 43793659-43793759 [-]
sense
OTTHUMT00000132897 ; TP53BP1-002; intron 1
OTTHUMT00000315929 ; TP53BP1-012; intron 1
ENST00000263801 ; TP53BP1-002; intron 1
ENST00000477089 ; TP53BP1-012; intron 1
Database links

Mature sequence hsa-miR-1282

Accession MIMAT0005940
Sequence

9 - 

ucguuugccuuuuucugcuu

 - 28

Get sequence
Deep sequencing17 reads, 17 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).