Stem-loop sequence hsa-mir-1278

AccessionMI0006425 (change log)
Symbol HGNC:MIR1278
DescriptionHomo sapiens miR-1278 stem-loop
Gene family MIPF0000591; mir-1278
Stem-loop
   --                             c   ga   c 
5'   auuugcucauagaugauaugcauaguacu cca  acu a
     ||||||||||||||||||||||||||||| |||  ||| u
3'   uaagcgaguaucuacuauacgugucauga ggu  uga u
   ga                             u   --   a 
Get sequence
Deep sequencing
2194 reads, 0 reads per million, 85 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 193136503-193136583 [+]
sense
OTTHUMT00000086696 ; CDC73-001; intron 10
ENST00000367435 ; CDC73-001; intron 10
Database links

Mature sequence hsa-miR-1278

Accession MIMAT0005936
Sequence

50 - 

uaguacugugcauaucaucuau

 - 71

Get sequence
Deep sequencing2120 reads, 84 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).