Stem-loop sequence hsa-mir-1276

AccessionMI0006416 (change log)
Symbol HGNC:MIR1276
DescriptionHomo sapiens miR-1276 stem-loop
Gene family MIPF0000652; mir-1276
Stem-loop
   --  -   gcu    -a   a  c u         ---- -   g 
5'   cc cca   aggu  aag gc c guggagaca    c cug a
     || |||   ||||  ||| || | |||||||||    | |||  
3'   gg ggu   uccg  uuc cg g caccucugu    g gac u
   uc  c   agu    gg   a  a u         acaa a   u 
Get sequence
Deep sequencing
866 reads, 0 reads per million, 74 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 85770496-85770578 [-]
sense
OTTHUMT00000417044 ; RP11-561C5.4-005; intron 1
OTTHUMT00000417046 ; RP11-561C5.4-003; intron 1
OTTHUMT00000417047 ; RP11-561C5.4-002; intron 1
OTTHUMT00000417048 ; RP11-561C5.4-004; intron 1
ENST00000560756 ; RP11-561C5.4-005; intron 1
ENST00000560811 ; RP11-561C5.4-003; intron 1
ENST00000560405 ; RP11-561C5.4-002; intron 1
ENST00000558470 ; RP11-561C5.4-004; intron 1
ENST00000357253 ; RP11-561C5.4-201; intron 1
Database links

Mature sequence hsa-miR-1276

Accession MIMAT0005930
Sequence

12 - 

uaaagagcccuguggagaca

 - 31

Get sequence
Deep sequencing814 reads, 68 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).