Stem-loop sequence hsa-mir-1273h

AccessionMI0025512 (change log)
Symbol HGNC:MIR1273H
DescriptionHomo sapiens miR-1273h stem-loop
Literature search

6 open access papers mention hsa-mir-1273h
(34 sentences)

Stem-loop
            gacua   c                        a  g        ucg  g 
5' uacuugggu     agg aggauugcuugagccugggagguc ag cugcagug   ug u
   |||||||||     ||| |||||||||||||||||||||||| || ||||||||   ||  
3' gugagcucg     ucc uccuaacgaauucggacccuccag uc gacgucgu   ac c
            -----   -                        c  a        ucg  a 
Get sequence
Deep sequencing
2474 reads, 23.4 reads per million, 137 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 24203116-24203231 [+]
sense
OTTHUMT00000254504 ; PRKCB-001; intron 16
OTTHUMT00000254505 ; PRKCB-002; intron 16
ENST00000321728 ; PRKCB-001; intron 16
ENST00000303531 ; PRKCB-002; intron 16
Database links

Mature sequence hsa-miR-1273h-5p

Accession MIMAT0030415
Sequence

33 - 

cugggaggucaaggcugcagu

 - 53

Get sequence
Deep sequencing749 reads, 103 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-1273h-3p

Accession MIMAT0030416
Sequence

71 - 

cugcagacucgaccucccaggc

 - 92

Get sequence
Deep sequencing1039 reads, 74 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).