Dead miRNA entry

miRNA accession:
MI0014254
miRNA ID:
hsa-mir-1273d
Comment:
Many of the miRNA loci annotated as mir-1273 family members have patterns of mapped reads from RNAseq experiments that are not consistent with the gene being processed as a miRNA. The reads may be derived from SRP RNA, or derived Alu repeats. hsa-mir-1273a,b,d,e,f,g are removed the database.

Previous miRNA entry

Stem-loop sequence hsa-mir-1273d

AccessionMI0014254 (change log)
Symbol HGNC:MIR1273D
DescriptionHomo sapiens miR-1273d stem-loop
Gene family MIPF0000579; mir-1273
Stem-loop
   ---gaa      ---ga     uga        c       a  - aa 
5'       ucgcuu     accca   gguugagg ugcagug gc c  g
         ||||||     |||||   |||||||| ||||||| || |   
3'       agcgag     ugggu   ccgacuuc acgucac cg g  a
   cuucaa      aacag     ---        -       -  u cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsa-miR-1273d

Accession MIMAT0015090
Sequence

10 - 

gaacccaugagguugaggcugcagu

 - 34

Get sequence
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).