Stem-loop sequence hsa-mir-1273c

AccessionMI0014171 (change log)
Symbol HGNC:MIR1273C
DescriptionHomo sapiens miR-1273c stem-loop
Gene family MIPF0001481; mir-1273c
Literature search

6 open access papers mention hsa-mir-1273c
(34 sentences)

Stem-loop
   ug    c         a        c       uuuu 
5'   cagc ugggcgaca aacgagac cugucuu    u
     |||| ||||||||| |||||||| |||||||    u
3'   gucg acccguugu uugcucug gacagag    u
   ag    a         c        a       ucuu 
Get sequence
Deep sequencing
1587 reads, 12.9 reads per million, 147 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 154853360-154853436 [+]
intergenic
Database links

Mature sequence hsa-miR-1273c

Accession MIMAT0015017
Sequence

10 - 

ggcgacaaaacgagacccuguc

 - 31

Get sequence
Deep sequencing579 reads, 99 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).