Dead miRNA entry

miRNA accession:
MI0006409
miRNA ID:
hsa-mir-1273a
Comment:
Many of the miRNA loci annotated as mir-1273 family members have patterns of mapped reads from RNAseq experiments that are not consistent with the gene being processed as a miRNA. The reads may be derived from SRP RNA, or derived Alu repeats. hsa-mir-1273a,b,d,e,f,g are removed the database.

Previous miRNA entry

Stem-loop sequence hsa-mir-1273a

AccessionMI0006409 (change log)
Previous IDshsa-mir-1273
Symbol HGNC:MIR1273A
DescriptionHomo sapiens miR-1273a stem-loop
Gene family MIPF0000579; mir-1273
Stem-loop
   --u    c     aa      --gaa       gg     gu       a  -  a 
5'    gagg aggag  uugcuu     cccgggu  uggag  ugcagug gc ca g
      |||| |||||  ||||||     |||||||  |||||  ||||||| || ||  
3'    uucu uucuc  aacgaa     ggguccg  accuc  acgucac cg gu a
   agg    -     ag      acagc       --     --       -  c  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsa-miR-1273a

Accession MIMAT0005926
Previous IDshsa-miR-1273
Sequence

76 - 

gggcgacaaagcaagacucuuucuu

 - 100

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).