Stem-loop sequence hsa-mir-1272

AccessionMI0006408 (change log)
Symbol HGNC:MIR1272
DescriptionHomo sapiens miR-1272 stem-loop
Gene family MIPF0000645; mir-1272
Literature search

5 open access papers mention hsa-mir-1272
(12 sentences)

Stem-loop
   --    au      --u   ug g    u aug     ---a a      --aa   u   cagug    ua 
5'   ccag  cagauc   ggg  c auga g   gcagc    a uucuga    acg gcu     ucuu  u
     ||||  ||||||   |||  | |||| |   |||||    | ||||||    ||| |||     ||||   
3'   gguc  gucugg   cuc  g ugcu c   cgucg    u aagauu    ugc cga     agga  a
   au    gg      ugu   gu -    - -ga     gaug a      caaa   -   ----a    ca 
Get sequence
Deep sequencing
313 reads, 67.6 reads per million, 34 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 64762387-64762515 [-]
antisense
OTTHUMT00000418703 ; ZNF609-004; intron 1
OTTHUMT00000418704 ; RP11-702L15.4-001; exon 1
ENST00000416172 ; ZNF609-004; intron 1
ENST00000558443 ; RP11-702L15.4-001; exon 1
Database links

Mature sequence hsa-miR-1272

Accession MIMAT0005925
Sequence

20 - 

gaugaugauggcagcaaauucugaaa

 - 45

Get sequence
Deep sequencing291 reads, 28 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).