Stem-loop sequence hsa-mir-1270

AccessionMI0006407 (change log)
Previous IDshsa-mir-1270-1
Symbol HGNC:MIR1270
DescriptionHomo sapiens miR-1270 stem-loop
Gene family MIPF0000877; mir-1270
Literature search

2 open access papers mention hsa-mir-1270
(3 sentences)

Stem-loop
   --  c         cu       u         g     ggu 
5'   ca agaguuaua  ggagaua ggaagagcu uguug   a
     || |||||||||  ||||||| ||||||||| |||||    
3'   gu ucucggugu  cuucuau ucuuuucgg acaau   u
   ac  u         au       u         -     gaa 
Get sequence
Deep sequencing
2997 reads, 0 reads per million, 104 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 20399272-20399354 [-]
sense
OTTHUMT00000462901 ; CTC-260E6.6-006; intron 2
ENST00000593655 ; CTC-260E6.6-006; intron 2
Database links

Mature sequence hsa-miR-1270

Accession MIMAT0005924
Sequence

13 - 

cuggagauauggaagagcugugu

 - 35

Get sequence
Deep sequencing5962 reads, 103 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).