Stem-loop sequence hsa-mir-1269a

AccessionMI0006406 (change log)
Previous IDshsa-mir-1269
Symbol HGNC:MIR1269A
DescriptionHomo sapiens miR-1269a stem-loop
Gene family MIPF0000984; mir-1269
Literature search

4 open access papers mention hsa-mir-1269a
(85 sentences)

Stem-loop
   --    uugccua                u                a  cuga  ac 
5'   ugga       gaccagggaagccagu ggcauggcucagucca gu    cc  c
     ||||       |||||||||||||||| |||||||||||||||| ||    ||   
3'   accu       cuggucccuucgguca ucgugccgagucaggu cg    gg  u
   cg    -------                -                c  -uaa  ag 
Get sequence
Deep sequencing
22098 reads, 82.4 reads per million, 91 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 66276824-66276928 [+]
antisense
OTTHUMT00000362106 ; EPHA5-003; intron 5
OTTHUMT00000251388 ; EPHA5-001; intron 7
OTTHUMT00000251389 ; EPHA5-002; intron 7
OTTHUMT00000362135 ; EPHA5-004; intron 7
ENST00000432638 ; EPHA5-003; intron 5
ENST00000273854 ; EPHA5-001; intron 7
ENST00000354839 ; EPHA5-002; intron 7
ENST00000511294 ; EPHA5-004; intron 7
Database links

Mature sequence hsa-miR-1269a

Accession MIMAT0005923
Previous IDshsa-miR-1269
Sequence

67 - 

cuggacugagccgugcuacugg

 - 88

Get sequence
Deep sequencing19842 reads, 80 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).