Stem-loop sequence hsa-mir-1268b

AccessionMI0016748 (change log)
Symbol HGNC:MIR1268B
DescriptionHomo sapiens miR-1268b stem-loop
Literature search

17 open access papers mention hsa-mir-1268b
(28 sentences)

Stem-loop
   a    ---   g   ugg  g    g 
5'  cccg   ggc ugg   ug gggu g
    ||||   ||| |||   || ||||  
3'  gggu   ucg acc   au uccg g
   a    uga   -   uua  g    u 
Get sequence
Deep sequencing
5712 reads, 53.8 reads per million, 156 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 80098828-80098877 [+]
antisense
OTTHUMT00000277185 ; CCDC57-004; intron 1
OTTHUMT00000442460 ; CCDC57-018; intron 1
OTTHUMT00000277186 ; CCDC57-005; intron 4
OTTHUMT00000277182 ; CCDC57-001; intron 15
ENST00000392346 ; CCDC57-004; intron 1
ENST00000582040 ; CCDC57-018; intron 1
ENST00000419322 ; CCDC57-005; intron 4
ENST00000392347 ; CCDC57-201; intron 14
ENST00000389641 ; CCDC57-001; intron 15
Database links

Mature sequence hsa-miR-1268b

Accession MIMAT0018925
Sequence

4 - 

cgggcgugguggugggggug

 - 23

Get sequence
Deep sequencing5405 reads, 155 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).