Stem-loop sequence hsa-mir-1267

AccessionMI0006404 (change log)
Symbol HGNC:MIR1267
DescriptionHomo sapiens miR-1267 stem-loop
Gene family MIPF0000640; mir-1267
Literature search

6 open access papers mention hsa-mir-1267
(17 sentences)

Stem-loop
   --   --         c                   ccuc 
5'   cuc  ccaaaucuc uguugaaguguaaucccca    c
     |||  ||||||||| |||||||||||||||||||     
3'   gag  gguuuagag acaacuuuacauuaggggu    a
   ag   ua         u                   uacg 
Get sequence
Deep sequencing
227 reads, 3.33 reads per million, 60 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr13: 107531171-107531248 [-]
intergenic
Database links

Mature sequence hsa-miR-1267

Accession MIMAT0005921
Sequence

12 - 

ccuguugaaguguaaucccca

 - 32

Get sequence
Deep sequencing47 reads, 30 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).