Stem-loop sequence hsa-mir-1265

AccessionMI0006401 (change log)
Symbol HGNC:MIR1265
DescriptionHomo sapiens miR-1265 stem-loop
Gene family MIPF0000688; mir-1265
Literature search

2 open access papers mention hsa-mir-1265
(8 sentences)

Stem-loop
   --           c                       aag ca 
5'   augguuuggga ucaggauguggucaaguguuguu   g  u
     ||||||||||| |||||||||||||||||||||||   |   
3'   uaccaaaccuu aguuuuacaccaguucauaacaa   c  g
   ua           a                       gga uu 
Get sequence
Deep sequencing
18 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 14436576-14436661 [+]
antisense
OTTHUMT00000046887 ; FRMD4A-001; intron 1
OTTHUMT00000046888 ; FRMD4A-002; intron 1
ENST00000493380 ; FRMD4A-001; intron 1
ENST00000475141 ; FRMD4A-002; intron 1
Database links

Mature sequence hsa-miR-1265

Accession MIMAT0005918
Sequence

14 - 

caggauguggucaaguguuguu

 - 35

Get sequence
Deep sequencing11 reads, 8 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).