Stem-loop sequence hsa-mir-1264

AccessionMI0003758 (change log)
Symbol HGNC:MIR1264
DescriptionHomo sapiens miR-1264 stem-loop
Gene family MIPF0000098; mir-95
Literature search

3 open access papers mention hsa-mir-1264
(3 sentences)

Stem-loop
   --------    c     -    u        aaagaa 
5'         aggu cucaa uaag auuuguug      u
           |||| ||||| |||| ||||||||      a
3'         ucca gaguu auuc ugaacaac      a
   guguauug    c     u    -        caaaua 
Get sequence
Deep sequencing
1200 reads, 1.64 reads per million, 61 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 114652655-114652723 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-1264
hsa-mir-1912chrX: 114651544-114651623 [+]
hsa-mir-1264chrX: 114652655-114652723 [+]
Database links

Mature sequence hsa-miR-1264

Accession MIMAT0005791
Sequence

42 - 

caagucuuauuugagcaccuguu

 - 64

Get sequence
Deep sequencing1029 reads, 42 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).