Stem-loop sequence hsa-mir-1263

AccessionMI0006398 (change log)
Symbol HGNC:MIR1263
DescriptionHomo sapiens miR-1263 stem-loop
Gene family MIPF0000687; mir-1263
Literature search

3 open access papers mention hsa-mir-1263
(6 sentences)

Stem-loop
   --                  c c               u   a 
5'   cuaccccaaaauauggua c uggcauacugaguau uua u
     |||||||||||||||||| | ||||||||||||||| |||  
3'   gaugggguuuuauaccgu g accguaugacucaua ggu a
   ac                  u u               c   c 
Get sequence
Deep sequencing
32 reads, 0 reads per million, 18 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 164171471-164171556 [-]
intergenic
Database links

Mature sequence hsa-miR-1263

Accession MIMAT0005915
Sequence

13 - 

augguacccuggcauacugagu

 - 34

Get sequence
Deep sequencing26 reads, 16 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).