Stem-loop sequence hsa-mir-1262

AccessionMI0006397 (change log)
Symbol HGNC:MIR1262
DescriptionHomo sapiens miR-1262 stem-loop
Gene family MIPF0000595; mir-1262
Literature search

2 open access papers mention hsa-mir-1262
(2 sentences)

Stem-loop
   --   u     ---g  gau    g  -------   g         gaaag 
5'   auc acaau    gu   gggu aa       uuu uagaaggau     u
     ||| |||||    ||   |||| ||       ||| |||||||||      
3'   uag uguua    ca   uccg uu       aag gucuuccua     c
   ua   -     agaa  acu    g  uuuaauc   g         agaaa 
Get sequence
Deep sequencing
2285 reads, 0 reads per million, 118 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 68183518-68183610 [-]
sense
OTTHUMT00000026355 ; GNG12-001; intron 2
ENST00000370982 ; GNG12-001; intron 2
Database links

Mature sequence hsa-miR-1262

Accession MIMAT0005914
Sequence

14 - 

augggugaauuuguagaaggau

 - 35

Get sequence
Deep sequencing2273 reads, 116 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).