Stem-loop sequence hsa-mir-1257

AccessionMI0006391 (change log)
Symbol HGNC:MIR1257
DescriptionHomo sapiens miR-1257 stem-loop
Gene family MIPF0000998; mir-1257
Stem-loop
   --  c u    --u    c    --  a     u      uu --   ccc   u ca   c 
5'   gc c gggc   ugug uugg  gg gugaa gauggg  c  uga   cca g  ccc u
     || | ||||   |||| ||||  || ||||| ||||||  |  |||   ||| |  |||  
3'   cg g cccg   gcac aacc  cc cacuu cuaccc  g  acu   ggu c  ggg g
   uc  u u    uuc    c    gu  c     c      cg uc   -ac   c cc   u 
Get sequence
Deep sequencing
234 reads, 8.7 reads per million, 46 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr20: 61953546-61953662 [-]
antisense
OTTHUMT00000315835 ; COL20A1-009; intron 3
OTTHUMT00000080133 ; COL20A1-004; intron 6
OTTHUMT00000144594 ; COL20A1-005; intron 26
OTTHUMT00000080130 ; COL20A1-001; intron 26
OTTHUMT00000144595 ; COL20A1-006; intron 27
ENST00000455906 ; COL20A1-009; intron 3
ENST00000415763 ; COL20A1-004; intron 6
ENST00000479501 ; COL20A1-005; intron 26
ENST00000422202 ; COL20A1-001; intron 26
ENST00000358894 ; COL20A1-006; intron 27
ENST00000326996 ; COL20A1-201; intron 27
ENST00000435874 ; COL20A1-202; intron 27
Database links

Mature sequence hsa-miR-1257

Accession MIMAT0005908
Sequence

22 - 

agugaaugauggguucugacc

 - 42

Get sequence
Deep sequencing210 reads, 32 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).