Stem-loop sequence hsa-mir-1256

AccessionMI0006390 (change log)
Symbol HGNC:MIR1256
DescriptionHomo sapiens miR-1256 stem-loop
Gene family MIPF0000594; mir-1256
Literature search

4 open access papers mention hsa-mir-1256
(5 sentences)

Stem-loop
   ------     gc          uuugaagcuuu    c  g             ac      u a 
5'       aguca  cuguugaagc           gaug ca gcauugacuucuc  uagcug g a
         |||||  ||||||||||           |||| || |||||||||||||  |||||| | a
3'       ucggu  gauaacuuug           cuac gu cguaacugaagag  aucgau c g
   acuuug     -a          ---------uu    a  a             aa      c u 
Get sequence
Deep sequencing
1658 reads, 0.862 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 20988314-20988432 [-]
intergenic
Database links

Mature sequence hsa-miR-1256

Accession MIMAT0005907
Sequence

35 - 

aggcauugacuucucacuagcu

 - 56

Get sequence
Deep sequencing386 reads, 65 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).