Stem-loop sequence hsa-mir-1255b-1

AccessionMI0006435 (change log)
Symbol HGNC:MIR1255B1
DescriptionHomo sapiens miR-1255b-1 stem-loop
Gene family MIPF0000506; mir-1255
Literature search

3 open access papers mention hsa-mir-1255b-1
(3 sentences)

Stem-loop
   --     ---a ga       aa    u    ua 
5'   uacgg    u  gcaaaga  gugg uucu  a
     |||||    |  |||||||  |||| ||||   
3'   guguc    a  uguuucu  cauc aagg  a
   aa     guag ag       --    u    ua 
Get sequence
Deep sequencing
4202 reads, 4.55 reads per million, 110 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 36426366-36426428 [-]
intergenic
Database links

Mature sequence hsa-miR-1255b-5p

Accession MIMAT0005945
Previous IDshsa-miR-1255b
Sequence

3 - 

cggaugagcaaagaaagugguu

 - 24

Get sequence
Deep sequencing8361 reads, 111 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).