Stem-loop sequence hsa-mir-1255a

AccessionMI0006389 (change log)
Symbol HGNC:MIR1255A
DescriptionHomo sapiens miR-1255a stem-loop
Gene family MIPF0000506; mir-1255
Literature search

7 open access papers mention hsa-mir-1255a
(12 sentences)

Stem-loop
   --au    aauccuuu                            ag   a          
5'     ugga        gaguugcuucucaaggaugagcaaagaa  uag uuuuuuaga 
       ||||        ||||||||||||||||||||||||||||  ||| |||||||| u
3'     accu        cucaacgaagaguuccuacucguuucuu  auc aagaaaucu 
   aauu    ----auuc                            cu   a          
Get sequence
Deep sequencing
5461 reads, 6.25 reads per million, 144 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 101330302-101330414 [-]
sense
OTTHUMT00000363578 ; EMCN-007; intron 4
OTTHUMT00000363549 ; EMCN-003; intron 8
OTTHUMT00000363548 ; EMCN-002; intron 10
OTTHUMT00000253699 ; EMCN-001; intron 11
ENST00000506300 ; EMCN-007; intron 4
ENST00000305864 ; EMCN-003; intron 8
ENST00000511970 ; EMCN-002; intron 10
ENST00000296420 ; EMCN-001; intron 11
Database links

Mature sequence hsa-miR-1255a

Accession MIMAT0005906
Sequence

28 - 

aggaugagcaaagaaaguagauu

 - 50

Get sequence
Deep sequencing5070 reads, 142 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).